1. Skip to navigation
  2. Skip to content
  3. Skip to sidebar


Join Project and FAQ

How to Join the Project
Contact Family Tree and get tested for a minimum of 67 markers.

Then fill out the forms listed in the grey area at the bottom of this page: Waiver Form, Information Release Form and Ancestor Report Form. Them submit them to Barbara Denny George, project administrator.. (Click on each form below in the grey area at the bottom of this page to download them. If you have trouble with downloading them, email Barbara to receive these forms.)
That’s it! Then your results can be compared to other Dennys tested and you can be placed with one of the established Denny lines or begin a placement for an independent line of Denneys.

Frequently Asked Questions

Q1. What is DNA?

DNA is short for Deoxyribonucleic Acid. Most of our body’s cells contain a complete sample of our DNA. It is sometimes known as the "blueprint of life" because it contains a genetic code.

DNA is a string-like molecule that is composed of phosphate, deoxyribose (a sugar) and four bases or basic building blocks. The bases are strung together and if stretchedt, the DNA from just one cell would be over 6 feet long. However, it is coiled and twisted until it can be packed into a single cell. There are some 3 billion of these bases (building blocks) in a human being, and they were finally all "mapped" in 2003 as the ˜Human Genome’ project. See http://en.wikipedia.org/wiki/DNA if you want more information.

Back to the Top

Q2. What are chromosomes?

Simply put, chromosomes are coiled “thread-like” packages of DNA that are located in the nucleus of a cell. Different kinds of organisms have different numbers of chromosomes.

Humans have 23 pairs of chromosomes (or 46 chromosomes in all). Twenty-two pairs of the chromosomes “pair up” (with half coming from the mother and half coming from the father). So, a child gets half of his/her chromosomes from the mother and half from the father. However, two of these chromosomes are called sex chromosomes (the 23rd pair).

The mother always contributes an X chromosome in her egg cell, but the father can contribute either an X or a Y chromosome via a sperm cell (a combination of XX = female and an XY = male).

In addition to determining “maleness”, the Y chromosome has a couple of special features that are of great value in genealogy. For one thing, it is only transmitted from father to son. Secondly, the genes and genetic markers of the Y-Chromosome are passed from father to son over many generations with only an occasional natural mutation (change). Thus, the Y-Chromosome manages to avoid the constant reshuffling of parental genes during the process of sex cell production (termed meiosis).

Back to the Top

Q3. What is a DNA test?

With regard to genealogy, there are two basic types of DNA tests available.

Y-DNA TESTS

MITOCHONDRIAL DNA (mtDNA)

Back to the Top

Q4.   Will a DNA test tell me who my ancestors are? If not, what will the test tell me?

No, a DNA test by itself cannot tell you who your ancestors are. However, a DNA test CAN tell you if two or more test participants share a common ancestor. For male cousins, it can also give you a probability of the number of generations back to your most recent common ancestor (MRCA). Thus, DNA testing is generally used only as a supplement to traditional genealogy research (family trees or pedigree charts).

Back to the Top

Q5.   Why should I join the Denny DNA Results Project?

If you truly interested in having an accurate Denny family history, you should always attempt to prove it with DNA testing. Here are just some of the reasons to use DNA testing.

Back to the Top

Q6.   How does the Denny DNA Surname Results Project Work?

The Y-Chromosome DNA test for genealogical research is now available from several reputable laboratories. The DNA testing does have a cost. We recommend Family Tree DNA as your testing lab. Be aware that we get a “group rate” with Family Tree DNA and other labs generally charge much more at this time and may take longer to get your test results back to you. The test has no medical or diagnostic use whatsoever and the anonymity of those being DNA tested can be preserved if they desire. Participants must pay for their own DNA test. Once you have the results, if you join our Results project, we can compare them to other tested lines and help analyze your results.

Back to the Top

Q7.   How much does the DNA test cost and who is your testing laboratory?

The cost depends on the number of DNA markers being tested and which testing lab you choose. We have arranged special prices with our test laboratories for our Denny DNA test group. We recommend the 67 or higher marker test.

Family Tree DNA uses the University of Arizona testing laboratory and has pretty quick turnaround time and credentials. Check their website for prices.

Back to the Top

Q8.  National Geographic and IBM are sponsoring a “Genographic Project”. I am a Denny male, so can I use those test results for the Denny DNA Surname Project?

Not directly since the Genographic Project is set up in an attempt to map  how mankind populated the planet ( mapping migration patterns for many thousands of years). The project is studying deep ancestry only.  It only tests for 12 Y-DNA markers but we now suggest a minimum of 60 - 67 markers for you to participate in this study.

Q9.  How long is my DNA sample kept by the testing laboratory?

Heritage keeps it for 6 months.  Family Tree for 25 years but you can request it be destroyed if you wish.

Q10. Is the actual spelling of my surname important?

Those researching their ancestry should be aware that as we go further back in time, the spelling of surnames becomes less and less significant, until surnames disappear entirely (about 1000 years ago). In essence, for all genealogical research, there is no difference in DENNY vs. DENNEY. DENNY is the most common form of the surname being researched in our project (in the USA). As you delve back into older records, other spelling variants such as Dana,Denne, Denn, Dennehy, Denning, Dening, Dinny, etc., can show up, and a few of those have survived or been carried down to the present time. Basically, you should consider all surnames that sound like Denn… or Dinn… as possible candidates for DNA testing for possible relationships. However, in my experience, the surname DENNIS is generally a separate family line today (and is much more common in usage in the USA than either DENNY or DENNEY). We will be comparing our results with the Dennis surname groups from time to time to see if we find any matches.

Back to the Top

Q11. What is a genetic marker?

The official scientific definition is: “A segment of DNA with an identifiable physical location on a chromosome and whose inheritance can be followed. A marker can be a gene, or it can be some section of DNA with no known function (a section termed “junk DNA”). Because DNA segments that lie near each other on a chromosome tend to be inherited together, markers are often used as indirect ways of tracking the inheritance pattern of a gene that has not yet been identified, but whose approximate location is known.”

If you're like me, that definition means very little when you read it for the first time. In layman's terms and for the Denny genealogist, a “genetic marker” on the Y-Chromosome has the following characteristics:

1)  It occurs at an identifiable physical locus (location) on a chromosome. This locus has a specific number assigned to it by DNA scientists, for example, DYS426.

2) The marker has an actual pattern of base combinations (A, T, G, and C) at that locus (location). For example, the pattern for the locus DYS426 might be:

GGTGACAAGACGAGACTTTGTGT/CAA/CAA/CAA/CAA/CAA/CAA/CAA/CAA/CAA/CAA/CAA/

     CAA/CACAACTAAATGAAGTGGTCATGCTTTCATACTTTGAG

Note that we chose this marker as an example, because it is one of the simpler patterns for markers that are currently being used for DNA testing for genealogy

3)  In your DNA test results, there is usually a number shown along with the marker name. This number specifies the number of repeats of the pattern. For example, 12 would indicate that the pattern shown in Step 2) above would occur 12 times consecutively on the Y-Chromosome. This number of repeats is usually called Short Tandem Repeats and is abbreviated STR.

In the DNA test report that you receive from the test lab (for this locus of DYS426), you will generally see a column header of DYS426 and in the row below it, the number 12, indicating that the typical pattern for DYS426 was found 12 times in your Denny DNA test.

There is a tradeoff between cost and accuracy. Some labs offer a 12-marker test, but it is better at showing who is NOT related that it is in specifying who is actually related to you. If two people have one or two markers that are different in a 12-marker test, then they are probably unrelated in historic time (10,000 years). However, a one-marker difference on a 25-marker test can mean a common ancestor at less than 340 years ago. Some examples of determining what the probability of a relationship of an ancestor that is back in time 10 generations and for which DNA test results vary by only one DNA marker:    

Back to the Top

Q12. How many markers must match for two persons to be considered related?

The answer is that it depends on how many markers are being tested for DNA. Here are a couple simple rules of thumb for determining if two test participants are related via a common ancestor:

For a 25 marker test, from 23 to 25 markers must match.

For a 43 marker test, from 39 to 43 markers must match.

Obviously, for two Denny males, the higher the number of markers that match), the higher the probability that they are related. There are calculators which will help you determine the probability of a relationship more exactly.

Back to the Top

Q13. Is it possible to upgrade from less markers to more markers later ?

Yes, most DNA testing labs allow this to be done very easily. Family Tree DNA keeps your DNA sample at the University of Arizona test lab for 25 years. You can usually upgrade at any time. You can then request any of their future tests during that time period without having to resubmit a DNA sample. DNA Heritage destroys your DNA test swabs after 6 months, so if you want to take a different type of DNA test (SNP or mtDNA, for example), you will have to order another DNA test kit and submit it before your 6 months is up.

Back to the Top

Q14. If there is no Y-Chromosome match found between two supposed descendants of a common ancestor, what does that mean?

It demonstrates with a very high degree of probability that the two males being DNA tested do not share a common male ancestor. Although this is true of the two males being tested, it may not be true for the complete family groups of the individuals who were tested, because there are a number of sources of “non-paternal” events. Usually at this point, you should carefully select a third DNA test candidate for the lines being looked at, to determine where and when a non-paternal event may have occurred.

Back to the Top

Q15. My maiden name is DENNY and I would love to have DNA information but I am female, I have no brothers, and my father is deceased. There are no living males with the surname Denny in my family, only male cousins named DENNY and some are quite distantly related.

Your male cousins should have the same Y-DNA as your father and his male ancestors that had the surname DENNY. Testing your cousins is the same as testing your late father if they are the natural children of your DENNY ancestors. That is because the Y-chromosome passes unchanged from father to son except for a few random mutations. So, if your father and your cousins have any known common ancestor, even back to your 5th great grandfather, or beyond, the DNA test sample should be the same as testing your own father, give or take a mutation or two.

Back to the Top

Q16. Can I use DNA testing instead of traditional genealogy research?

No, DNA testing should be used only as a supplement to your traditional research. It has only very limited value when used alone.

Q17. Are there any downsides to getting DNA tested?

A possible negative in getting tested is that you may not get the result you hope for (or expect). Most true genealogists will want to use the new DNA data to prove or disprove their lines and “let the chips fall where they may.” They will consider the DNA test to be additional information, and will continue their research by taking a slightly different tack.

However, for those individuals who may experience significant distress when they find that the surname ancestor that they have shown on their family tree is not really theirs, it could be a real problem. You may also discover a non-paternal event (infidelity, adoption, a legal surname change, etc.) which can be very disturbing, especially if it is a recent event. You should always try to find a third DNA test participant to confirm the non-paternal event before relying upon DNA test results. Should the non-paternal event “prove out,” be sure to use a great deal of discretion if you feel you must reveal that information to your family.

There are several scenarios that could account for a non-paternity event. The two most common situations are either infidelity or an un-recorded adoption. Since there were many adult deaths on the frontier, children were frequently raised by relatives or friends, with the adoptive parents giving the child their own last name. Where infidelities or adoptions have long been rumored in family tradition and are now proven, there can be some real satisfaction in determining this. Where an infidelity or an adoption occurred in a well-documented family, identifying when the event occurred helps in clarifying the DNA profile of descendants who were born after the event. However, where a non-paternity event occurs in a family without extensive documentation, it can be very disruptive and may prevent the participant from obtaining matches within the surname. As more people are tested however, and as DNA test results can be compared more efficiently, the participant will have a far better chance of finding his real ancestors.

Back to the Top

Q18. How is the DNA test done?

The DNA test is as easy as brushing your teeth--the goal is to collect buccal cells from inside of your mouth. For either testing company, there is no collection of blood or hair, no doctors, and no visit to DNA collection specialists. You do not have to go anywhere.

You will contact the testing lab and make arrangements for a kit to be sent  to you. This test kit will contain two-three cheek scrapers and collection tubes. Before taking the samples, you must refrain from eating, teeth-brushing, or drinking milky drinks for at least two hours prior to the test.

You use the cheek scraper/brush on the inside of your mouth (similar to brushing your teeth). You then place the “scraper” portion inside a small vial as instructed in the kit. Then, the swabs are placed in a pre-addressed envelope (along with a signed release form for the testing) and mailed.

Back to the Top

Q19. Can I list my DNA test results elsewhere on the Internet (in addition to the Denny DNA Surname website) so other people can compare their results with mine and contact me if they find a match?

Yes, there are two primary websites that you should post your DNA test results upon (once you receive them from the testing lab). The two sites for posting your Y-DNA tests at this time are www.ybase.org         (maintained by DNA Heritage), and   www.ysearch.org    (maintained by Family Tree DNA).

There is another site where you can compare your Y-DNA test results as well: Sorenson Molecular Genealogy Foundation (SMGF) lets you input your test results at http://smgf.org/ysearch_input.jsp and find possible genetic matches or do a place and time analysis for your paternal line. Note however, that it takes from 9 months to a year for your results to show up at Sorenson, and you will have to find your results via your family tree information.

If you have been mtDNA tested, you should post your results to http://www.mtdnalog.org/ . If you have had a SNP test, you should post your results at http://www.kerchner.com/cgi-kerchner/ystrmutationrate.cgi  The forensic research community sponsors a site, http://yhrd.org/index.html     that lets advanced DNA test users search by their Y-STR haplotype (in various formats) either by geographic area or by ethnicity. You should use some caution when viewing your results here. For example, if you have many “matches” in England, that could occur simply because the database has a particularly large number of samples from England.

Back to the Top

Q20. What else (other than proving my ancestry) might a DNA test reveal?

The answer is that a DNA test will not reveal a thing beyond your ancestry--the test lab won't know if you test positive for a disease, have a hereditary gene for disease, etc. This is because the test looks only at the Y-Chromosome and then only at 43 - 67 specific loci (locations) in a region that is referred to as “junk DNA” (termed that way, because so far, if “junk DNA” does have a use, scientists haven't been able to figure out just what that use is).

Q21. Where did the Denny's and Denney's originate from?

Y-DNA testing (by itself) will not usually reveal that answer for us unless a proven (via DNA testing) pedigree chart goes back far enough, and that's very unlikely. However an additional SNP test can generally reveal the ancient origins of your paternal line. The second form of DNA testing (called mtDNA) can reveal possible maternal line origins, but it will not tell you how far back in time your maternal line goes (usually thousands of years).

Q22. There is only one living male person with the surname of DENNY in my family. Is there any point in joining the study if I don't have two or three family members who are DENNY surname males?

Yes, there is still potential value for you to join the DENNY DNA Results Project. The reason for testing at least two distantly related cousins in your line “validates” your family at least back to a common ancestor. A single DNA test could provide incorrect data for a family if there was a non-paternal event (infidelity, adoption, legal surname change, etc.) somewhere in the past. If your living male person takes the test, and matches other distant cousins in the study, you will have learned that your branch of the DENNY family is related to theirs (with little doubt). If the results do not match your distant cousins, and you cannot find any other male cousin to test to validate the result, at least your DNA sample results can sit there in the database until sometime in the future a match is made.

Back to the Top

Q23. I already know that my DENNY family came from somewhere in England. What am I going to learn from doing this DNA testing, that is new?

First of all, you may discover many DENNY cousins both here in the USA and in England. They may have new genealogical information and family histories that will be useful to yourself, and you will know that they are your relatives with little or no doubt. A couple of families named DENNY who were side-by-side in an early census that you assumed were brothers could actually be brothers, cousins, or merely a coincidence. DNA testing can prove this one way or another, assuming you can test the descendants of at least two “brothers”. Secondly, as the Denny DNA Surname Study expands over time, you may discover the exact village where your ancestors came from in England (assuming someone from England who is related to you, gets tested and has a proven ancestry back to that village), and possibly even church records, that could take you back even further in time.

Q24. All it takes is one break (non-paternal event) in the family a long time ago and you won't be able to match up an entire line of DENNY's. You will never be able to pull all of the DENNY lines together.

That is very likely true, but the purpose of this project is to help different DENNY families link up in order to further their genealogical research, wherever the truth may lead them. Even if long ago, a DENNY adopted a boy whose natural father was Mr. JONES and gave the adoptee the DENNY surname, all his male descendants will still have a common ancestor, which might prove useful. Also, someday, if a descendant male from Mr. JONES has a DNA test done, you may find a match to him and link him to the JONES family. This would enable you to go further back in time with your JONES family tree.

Back to the Top

Q25. My test results don't match any of the other DENNY lines on the Denny DNA Results website. Does that mean I'm not a DENNY?

No, it simply means that your line does not connect with those DENNY lines that have been tested so far. As more separate DENNY lines are posted, you may find a connection to one of them. What you should do is find a distant known cousin from your own line and have him tested to compare your results. If your results match, that will “prove” your line back to your most recent common ancestor or MCRA (for yourself and your cousin). Another reason that you may not match other lines (there's still a non-paternal event here) is that your line may be much older or younger than the lines currently being tested. For example, if 20 men are tested and 19 are very similar, but one is very different, it may turn out that 19 of the men descend from the same person who perhaps lived 250 years ago, and this person was adopted or illegitimate, while the man that doesn't match the other 19, descends from the original DENNY blood line that goes back 700 years.

Back to the Top

Q25. Can my DNA test results be used as a paternity test?

Strictly speaking, no, the tests done for this project are not paternity tests. (There are specific DNA tests for this purpose that are done by several DNA testing labs.) The tests here cannot prove exactly WHO an individual's father was, but they can reveal general information about a paternal line, which can be helpful where an individual's paternity is uncertain. For instance, suppose that John was born out of wedlock or less than nine months after his parents married. Comparing test results between one of John's descendants with those of a descendant of one of John's brothers (or one of his uncles, etc.) could help ease potential doubts about John's paternity (but would not eliminate a brother or uncle as the possible father--as a DNA paternity test would). On the other hand, DNA test results that do not match could indicate an instance of non-paternity.

Back to the Top

Q26. What are SNP's?

SNP's (Single Nucleotide Polymorphisms) are mutations which occur very rarely, perhaps only once in all of human history. SNP is pronounced SNIP. A SNP occurs when a single base (or nucleotide) is replaced with another base, for example, a T might become an A in the following Y-DNA strand: TCGAGTCAGC mutates into TCGAGACAGC. These mutations occur very rarely because of “proofreading enzymes” that are built into DNA. If you consider a single locus (location) on the DNA string, there is only about one chance in 50,000,000 that a change will occur between one generation and the next. Going way back in time, your ancient ancestry will “converge” on a founding father who first developed the SNP (in the case of Y-DNA) and on a founding mother (in case of mtDNA), each of whom was the first to develop that specific mutation or SNP. (This does not mean that the founding father and mother were man and wife--they may have even been lived in regions in the world that are far from one another.)

Back to the Top

Q27. What are Haplogroups?

A HAPLOGROUP is a cluster of people who share approximately the same haplotype (the numeric values for each tested DNA marker are nearly the same for many people). In other words, your haplotype consists of your individual DNA marker values from your DNA test (DYS=14, DYS385a=11, etc. for up to 43 markers at present). More importantly, their haplotype also has a common SNP (a distinctive marker that all have inherited from a single ancestor). SNP's are actually the basis for the formal definition of haplogroups. Everyone who has the new version ("allele" or SNP) belongs to the same haplogroup, because they inherited it from the same common ancestor, the founding father who lived thousands of years ago. The haplogroups really apply only to "deep ancestry” You don't need to know your haplogroup if you're interested in making connections in a genealogical time frame, but once they've been Y-DNA or mtDNA tested, many people are curious about their ancestors' ancient migration paths.

Back to the Top

Q28. Can a Y-DNA test tell me which Haplogroup I belong to?

Not really. A Y-DNA test can “indicate” which haplogroup you belong to, but a separate test is required to fully prove which haplogroup you in fact, belong to--especially if you have a rare haplotype (set of DNA marker values). Family Tree will predict your haplogroup if possible.

Back to the Top

Q29. Can I use Y-DNA testing to determine my paternal origins?

Every male in the world can be placed into just a few haplogroups (right now there are 18 major paternal lineages around the globe). There is a letter and an optional number (with perhaps another secondary letter, etc., such as L3f) assigned to each haplogroup. Some of the most common haplogroups in Europe are:

Haplogroup R1b is the most common haplogroup in Europe and occurs on the West Atlantic Coast of Europe, as far north as Scotland.

Haplogroup I is common across Central Europe and up into Scandinavia.

Haplogroup R1a is common in Eastern Europe and has also spread across into Central Asia and as far as India and Pakistan.

These three groups account for about 80% of today's European population. Note that the haplotypes in the haplogroups are not “perfect” matches. Statistics are used to determine “modal” values for each of the tested DNA markers.

Notice that these haplogroups apply to very large areas of Europe, so it would be impossible to tell if you were English, Irish, or Scottish by your haplogroup alone. (People from these areas are generally going to all fall into Haplogroup R1b.)

With current DNA testing technology, the only way you will able to really narrow down the area that your family may have come from is to find male Denny's in these areas who have proven pedigrees (perhaps back to a common village) and compare your Y-DNA tests with theirs. If your DNA markers match theirs, and the pedigree is solid, you've probably found your village of origin.

Back to the Top

Q30. Can I use mtDNA testing to determine my maternal origins?

Yes, the mtDNA test's basic purpose is to determine your maternal origins (going back in time for thousands of years). Every female in the world can be placed in a few haplogroups. There are about 30 major maternal (mtDNA) lineages worldwide. Note that this will only give you very broad regions (it is not country-specific in most cases, just as SNP testing for males is not).

Note that an mtDNA test does not provide any ethnic or racial percentages (for example, your amount of Native American blood). Also, it will not provide specific geographic information (for example the particular country your maternal line came from).

Finally, the mtDNA test follows ONLY the strict maternal line. If for example, your maternal great-grandmother's father was Native American, it would not be detected in this test.

Back to the Top

Q31. Can a DNA test tell me if I have Cherokee blood?

First of all, it depends on whether you are male or female and whether your Cherokee ancestor was male or female. If you are a male, if you descend from a Native American male, AND you can find a direct Native American male descendant cousin, you could compare your Y-DNA markers directly to prove you were related. (Obviously you must know your Native American male ancestor and at least of one his male descendant cousins to accomplish this.) If you are male or female and descend from a Cherokee female and can find a female cousin who descends from the same Cherokee female, you could compare mtNDA test results. However, even this would be very “iffy” since the common maternal ancestor could have occurred back thousands of years ago). See the next question for a more definitive answer.

Back to the Top

Q32. I think that one of my ancestors was an Apache Indian. Can DNA testing prove this?

DNA tests (at least at this time) cannot tell you which Native American tribe you descend from unless you know who your ancestor was and at least some of his/her descendant cousins who are living.

Back to the Top

Q33. Are there any DNA success stories?

One of the most famous DNA testing success stories deals with Thomas Jefferson and one of his slaves named Sally Hemings. Thomas Jefferson married Martha (Wayles) Skeleton, a young widow, on New Year's Day, 1772. Less than a year later, Martha's father, John Wayles died, leaving some 135 slaves to his daughter, Martha and his son-in-law, Thomas Jefferson. One of these slaves was Sally Hemings (who was the daughter of John Wayles and his slave, Elizabeth Hemings). Therefore, Sally Hemings was a half-sister of Thomas' wife Martha. Elizabeth Hemings (Sally's mother) was sired by an African mother and an English sea captain and thus, she was three-quarters white.

Back to the Top

Q34. How can I trace the source of a mutation (A difference in specific marker numbers)?

Suppose that John and William are both descended from a Benjamin Denny but John and William's DNA test results are not a perfect match. This means that somewhere between John and William, there has been a mutation. The way to determine when it occurred is to get other cousins tested, to see who else has inherited the mutation and who has not. This can be done in a methodical manner, by locating male descendants of brothers of their fathers, grandfathers, great-grandfathers, etc.

Q35. What if I have a cold, wear dentures (with adhesive), or am having chemotherapy-should I postpone my DNA test?

No, unless it is painful to rub a swab (oversized Q-Tip) in your mouth, then DNA sample collection under all of these circumstances is fine.

Q36. What if I've had a bone marrow transplant, can I still be DNA tested?

Yes. You should let your DNA administrator know you’ve had a bone marrow transplant.

Back to the Top

Q37. How can I interpret my Y-DNA test results? What if I match a non-Denny surname?

If you are among the first persons to take a Y DNA test for your Denny line, often you will not have any matches. This may be disappointing, although it is usually only a matter of time until you do find a match with another Denny line. To validate your lineage (for your own Denny line), it is recommended that you test the most distant cousin in your family tree. His result should match, or be an extremely close match, to your result. This step of testing another male in your family tree will scientifically validate your own result (and eliminate possible non-paternity events). If the two of you differ on any of the first 43 markers, a third male Denny would have to be tested to establish a modal (typical) haplotype for your Denny line. If you still don't have any matches, the best approach is to find some other males with the Denny surname (who were in the vicinity of your Denny line at some point back in time) to test. Your Denny DNA administrator will look at your results, analyze them with regard to other currently tested Denny lines, and post the report to the Denny DNA website
If a genetic match is found between you and another person, you will be informed via email.

If a genetic match is found between you and another individual who enters the library at some time in the future, both will be given the information that a potential match is in the database provided that BOTH of you have signed the Release Form. Only if both parties agree, will contact information concerning the separate parties be made available to the other party. In this way, all persons in the database will have the right to decide if they want to contact their probable genetic matches.

Most people in England adopted surnames by 1400, which is a little over 600 years ago. In a time frame of 600 years, depending on the figure used for years per generation, we would expect between 20 to 24 generations to have occurred, at 30 years per generation or at 25 years per generation. The current mutation rate estimated for the Y DNA Markers by the scientists is 1 mutation every 500 generations per DNA marker. For a 25-marker test, we would expect 1 or maybe 2 mutations if two people were related in the 1400's, in the time since surnames were adopted. Most likely a match with another surname is the result of being related before a genealogical time frame, or as a result of convergence. (Convergence is where Y-DNA results mutate over time towards another surname’s marker values, and as a result of changes, these two results now match or overlap.) As more people take a Y-DNA test and post their results, you will eventually find even more matches with other surnames.

Depending upon your ancestral country, and the surviving records, your family tree may be traced back to the 1800's, 1700's, or 1600's, and for a few rare family trees (usually where there is royalty involved), to a time well before then. If a 43/43 match with another surname is a result of a family taking in an orphan in 1425 - you will probably never find the paper record, if a paper record ever existed. Pursuing such a match will take valuable time away from more valuable traditional family history research.

In summary, we recommend not pursuing matches with other surnames, unless there is some genealogical evidence to support such a match. For those who have only tested 25 markers and are interested in pursuing the match, an upgrade to 67 Markers is recommended. Even at 43 Markers, you may have matches with other surnames, especially for Haplogroup R1b, and as a result of convergence. In rare cases, the match could indicate an unknown variant of the surname.

DNA testing is a tool to be used with your family history research. DNA testing provides additional information which is evaluated in conjunction with your family history research. If you have researched your family tree to the mid-1800's, pursuing a match with another surname that might have occurred from 1400 to 1800 is probably not the best investment of your time.

Matches with other surnames may have value for those who are not in the R1b haplogroup (which is so common), and whose ancestors have migrated and they are trying to identify the county of origin in the ancestral homeland. People frequently moved in the past, though often the distances were not very far per generation. Therefore, a cluster of your Y chromosome and close matches would exist in the ancestral county. For those whom you match with another surname, these matches can often be used to identify the ancestral county. If you are able to find enough matches with surnames of researchers who know their ancestral county, and one county is reported by a high percentage of matches or close matches with other surnames, you would then have a clue as to the ancestral county.

 

Q38. How secure is my DNA test sample?

Various DNA test labs (for surname projects) use differing security procedures but most appear to be secure enough to fully protect your DNA personal information.

FTDNA controls the Surnames Database Library (list of test participant names and test score data), while the University of Arizona controls and maintains the genetic library (your DNA samples). FTDNA is bound by State legislation and the University of Arizona is bound by both State and Federal privacy legislation. Your unique locator number accompanies your collection tubes to the testing lab. The computer-generated number and your name is the only information the testing lab will see.

Once your test has been completed, the results of your DNA test will be entered in a secure database. A comparison between your specific genetic markers and those of others in the database will then be performed.